PflFI from New England Biolabs

Product Specs
ItemPflFI
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberR0595S
Quantity2000 units
Concentration10 u/µL
ApplicationsDNA Manipulation
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeRestriction Enzyme
Temperature-20 C

Sequence

GACN/NNGTC

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Gain-of-function p53R172H mutation drives accumulation of neutrophils in pancreatic tumors, promoting resistance to immunotherapyCell ReportsAugust 24, 2021Despina Siolas, Emily Vucic, Emma Kurz, Cristina Hajdu, Dafna Bar-SagiTR-1003-G Hygromycin,Sigma Aldrich,Cat# 400053 G418,Sigma Aldrich,Cat# 345812 PfIFI,New England Biolabs,Cat# R0595S BsmBI,New England Biolabs,Cat#R0739S Shield-1,Cheminpharma,Cat# S1-001 Lipofectamine 3000,Life Technologies,Cat#

(2) Mitochondrial Dysfunction and Calcium Dysregulation in Leigh Syndrome Induced Pluripotent Stem Cell Derived NeuronsInternational Journal of Molecular SciencesApril 30, 2020Teresa Galera-Monge et al.5′CAGGCGTTTGTGTATGATATGTTTGCGGTTTCGATGACGTGG3´ was followed by digestion with restriction enzyme PflFI (New England Biolabs. Reference: R0595S) and quantified with the Agilent DNA 1000 Kit (Agilent, Santa Clara, CA, USA, 5067-1504) in an Agilent

(3) Mitochondrial Haplotype of the Host Stromal Microenvironment Alters Metastasis in a Non-cell Autonomous MannerCancer ResearchMarch 1, 2020Amanda E. Brinker, Carolyn J. Vivian, Thomas C. Beadnell, Devin C. Koestler, Shao Thing Teoh, Sophia Y. Lunt, Danny R. WelchBALB/cJ mtDNA results in the incorporation of a restriction digest site for Pflf1 (New England Biolabs: R0595S). Upon digest with Pflf1, cleavage will occur in animals with BALB/cJ mtDNA but not in those with FVB/NJ

(4) Mitochondrial Haplotype Alters Mammary Cancer Tumorigenicity and Metastasis in an Oncogenic Driver–Dependent MannerCancer ResearchDecember 15, 2017Amanda E. Brinker, Carolyn J. Vivian, Devin C. Koestler, Trevor T. Tsue, Roy A. Jensen, Danny R. WelchBALB/cJ mtDNA, results in the incorporation of a restriction digest site for Pflf1 (New England Biolabs: R0595S). Upon digest with Pflf1, cleavage will occur in animals with BALB/cJ mtDNA, but not in those with FVB/NJ

(5) Generation of Monoclonal Antibodies against Immunoglobulin Proteins of the Domestic Ferret (Mustela putorius furo)Journal of Immunology ResearchFebruary 14, 2017Greg A. Kirchenbaum, Ted M. Rosspurified with QIAquick PCR spin columns before digestion with restriction enzymes PflFI (NEB, Cat #R0595S) or PflmI (NEB, Cat #R0509S) to disrupt the rearranged Vκ21-12 gene from the SP2/0 fusion partner. After

Be the First to Write a Review!

PflFI

PflFI from New England Biolabs

Sequence

New England Biolabs

Citations (5)

Reviews

PflFI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map